biotechnologies, biodiversité des plantes

Tansgénèse. Exemples chez le maïs, pomme de terre et soja

La transgénèse peut concerner plusieurs espèces de plantes dont le maïs (ذرة, maize), la pomme de terre ( بطاطس, potato), le soja (فول الصويا, soybean) tranformées pour la résistance à la pyrale (lépidoptère), le doryphore (coléoptère), herbicide, respectivement.

Aller au Sommaire du cours

Sur cette même page:

- Cas 1. Maïs résistant à la chenille de la pyrale (lépidoptères) ذرة مقاومة لأسروعة الفراشة - حرشفيات الأجنحة

- Cas 2. Pomme de terre résistance au doryphore (coléoptère) بطاطس مقاوم للخنفساء - مغمدات الأجنحة

- Cas 3. Soja résistant aux herbicides. فول الصويا مقاوم لمبيدات الأعشاب


Cas 1. Maïs résistant à la chenille de la pyrale (lépidoptères)

En se référant au schéma ci-dessous relatif à la création d'un maïs transgénique (plante OGM), repérer les grandes étapes de la transgénèse couramment suivies dans la mise au point de plantes transgéniques et concernent :
1. Repérage d'un caractère intéressant dans un organisme vivant et identifier la protéine
2. Identification et isolement du gène d'intérêt
3. Réalisation et amplification d'une construction génique
4. Transfert de l'ADN = Introduction d'un ADN étranger dans une cellule de Maïs (différentes méthodes)
5. Contrôle de l'efficacité du transfert chez l'hôte
6. Sélection des cellules exprimant le gène ajouté par tri

Quels sont les deux modes de transfert du transgène de la résistance du Maïs à la chenille de la pyrale?

Maïs transgénique Bt

Pourquoi la toxine Cry1Ab n'est pas toxique pour l'Homme?

Des variétés de maïs ont été transformées par des firmes privées pour produire dans leurs tissus la toxine Cry1Ab de Bacillus thuringiensis (Bt), active contre la pyrale du maïs.
Cette stratégie de lutte offre plusieurs avantages :
- la toxine Cry1Ab n'est active que sur les insectes, aucune toxicité n'a été mise en évidence, ni pour les animaux domestiques ni pour l'homme.
- la toxine est produite principalement dans les parties vertes de la plante, qui ne sont jamais consommées par l'homme ;
- les premiers essais ont montré une remarquable efficacité de ces maïs

- Vidéo Maïs génétiquement modifié pour la résistance à la pyrale:
http://www.universcience.tv/video-mgm-mais-genetiquement-modifie-805.html

- Lien utile: Structure 3D de la toxine cry de Bacillus turingiensis (+ vidéo)


Vidéo sur la toxine Cry du Bacillus thuringiensis (Bt) et la transformation génétique des plantes pour la résistances aux insectes (narration Ar):



Recherche rapide dans ce site et les sites liés de l'auteur (Fr, Ar, Eng) - بحث سريع في هذا الموقع و المواقع المرتبطة للمؤلف



Cas des cultutres de la pomme de terre

Importance de la culture de la pomme de terre au Maroc. Au Maroc, la pomme de terre (potato, بطاطس) (Solanum tuberosum) est la première culture maraîchère des points de vue superficie et production (25% des cultures maraîchères). La production atteint annuellement 1,4 million de tonnes. Celle-ci est destinée principelement pour le marché local ( les marocains sont des gros consommateurs des pommes de terre).

Maghreb, Maroc


Au Maroc, les insectes ravageurs causent des dégâts pour la culture de la pomme de terre. C'est le cas de la noctuelle terricole Hydraecia micacea (ou ver gris, noctuelle mineuse de la pomme de terre), appelée aussi en Amérique du Nord 'Perce-tige de la pomme de terre', est un insecte de l'ordre des lépidoptères: Sur feuilles, les jeunes chenilles dévorent le parenchyme des feuilles. Il ne reste que l'épiderme desséché. Quand l'attaque est avancée, la culture semble grillée. Sur tubercule: les attaques de chenilles laissent des galeries qui évoluent en pourriture. Le Traitement au début de l'infestation avec des insecticides de contact à base de méthamidophos, méthomyl, chlopyriphos et de parathion. Y'a-t-il besoin de créer des pommes de terre transgéniques résistantes à la noctuelle terricole au Maroc ?

Extension de l'agriculture dans des conditions difficiles où la pomme de terre peut pousser. Au coeur du Sahara marocain, à plus de 1000 km au sud d'Agadir et à 350 km des frontières mauritaniennes, une pointe de verdure surgit du désert. Il est difficile d'en croire ses yeux. Sur 25 ha, s'étend une exploitation agricole de pointe. ..en raison de la qualité du climat à Dakhla, plusieurs autres variétés peuvent y être exploitées. Ainsi, pour la production sous serre sont cités, outre les melons et les pastèques, le poivron, l'aubergine, le concombre, la banane, l'ananas et le raisin de table. S'ajoute à cela la production de plein champ (pommes de terre, oignon, ail, concombre, courgette, artichaut, luzerne, maïs, banane).. Lire la suite.

Pomme de terre. Noctuelle

Cas 2. Pomme de terre résistance au doryphore (coléoptère) بطاطس مقاوم للخنفساء - مغمدات الأجنحة

Le doryphore (Leptinotarsa decemlineata, coléoptère,  مغمدات الأجنحة, Coleoptera, Beetles)

Le doryphore est le plus important ravageur de la pomme de terre au Canada et dans plusieurs régions aux États-Unis. Il se nourrit de plantes de la famille des Solanaceae. Parmi cette famille, on retrouve la pomme de terre, la tomate et l'aubergine qui sont sensibles à ses attaques.

Menace: En Afrique, le doryphore a été signalé en Libye, mais le Maroc en est indemne (Alain Fraval, 2001. Le doryphore : un grand conquérant fatigué ?, OPIE), toutefois sa présence en Libye n'était pas confirmée en 2006.

Son potentiel d'expansion est très important : il pourrait s'étendre dans toutes les régions tempérées du globe où la pomme de terre est cultivée et où il est encore absent, notamment en Asie orientale, dans le sous-continent indien, en Afrique du Nord et en Afrique australe, en Amérique latine, en Australie et en Nouvelle-Zélande. Le réchauffement climatique pourrait favoriser son extension vers le nord.

De nombreux insecticides sont utilisés pour tenter d'éliminer le doryphore, mais ils sont peu efficaces contre les pucerons se déplaçant rapidement d'un endroit à un autre, véhiculant le PLRV.

Bacillus turingiensis (BT)

Bactéries Bacillus turingiensis avec la toxine Cry

Depuis quelques années, des variétés de pomme de terre modifiées génétiquement pour être résistantes au doryphore sont disponibles. Un gène de la bactérie Bacillus thuringienssis (BT) a été introduit dans les plants de pomme de terre. La plante peut donc produire elle-même la toxine du BT qui détruit le système digestif des larves et des adultes du doryphore et provoque ainsi leur mort.
La culture de variétés de pommes de terre génétiquement modifiées (GM) a été approuvée dans le continent Nord Américain et autorisée depuis 1994 aux USA et 1995 au Canada, avec la résistance au doryphore seule ou une résistance associée avec une résistance au potyvirus (PVY) ou au luteovirus (PLRV) depuis 1998 aux USA et 1999 au Canada.
Ces variétés OGM sont exportées, depuis 2001, au Japon et en Australie où elles sont autorisées en alimentation humaine et animale.

En génie génétique, les tests d'efficacité de différentes constructions géniques ont été éssayés au champ. La pomme de terre est sensible au Colorado Potato Beetle (doryphore) et au puceron vert du pêcher qui transmet le PLRV provoquant l'enroulement des feuilles et la nécrose des tubercules.

Toxine Cry

Se déplaçant rapidement, le doryphore échape aux insecticides. L'obtention de plantes transgéniques permettant l'expression conjointe du gène Cry3A (codant une toxine de Bt efficace sur doryphore) et du gène capside du PLRV est décrite comme permettant une excellente protection.

Néanmoins, le doryphore peut devenir résistant au BT rapidement si on emploie les variétés OGM de façon abusive sans utilisation d'autres moyens de lutte.


Analyse d'article: Télécharger le document (version pdf) :http://ejournal.sinica.edu.tw/bbas/content/1996/1/bot371-03.pdf

 

Transgenic potato article

Le gène cryIA(a) de taille 2 kb, a été isolé du DNA du plasmide de la bactérie Bacillus turingiensis (Bt) par PCR (Schnepf et al., 1985). Deux séquences qui serviront d'amorces (amorce 5' et amorce 3', voir ci dessous) pour la PCR, ont élé isolées de la région codante du gène. Elles serviront pour amplifier le fragment de 2 kb.

le gène néomycine phosphotransférase II (NPTII) porté par le vecteur binaire a été utilisé pour la sélection des transformants (plantes) mis en culture dans un milieu contenant la kanamycine. Le gène nopaline synthase (nos) = promoteur, terminateur

- Amorce 5': TTGAGGTAACTTATGGATAACAATCCG
- Amorce 3': TCACTCAACTAAATTGGATACTTGATCA

1/ Par quelle méthode les auteurs ont fait le transfert du transgène?

Il s'agit d'un transfert binaire. Ici les plants de pomme de terre ont été inoculés avec Agrobacterium tumefaciens C58C1 (= plasmide hlper (pGV2260) + plasmide pBT121A). Le plasmide Helper va stimuler l'introduction du plasmide recombiné dans A. tumefasciens qui se retrouve avec deux plasmides.

2/ Comment les auteurs révèlent la présence du DNA du transgène intégré dans la plante hôte?

Préparation d'une sonde radioactive à partir du transgène cryIA/ Par hydrolyse avec E. coli du transgène, un fragment d'environ 0,8 kb du gène cryIA, a été isolé et marqué au 32P radioactif. Cette sonde s'hybridera avec l'ADN extrait des feuilles des transformants (plantes) et préalablement digéré par HindIII et séparé ensuite par électrophorèse sur gel. Ainsi cette méthode 'southern blotting' a permis de révéler des fragments d'ADN de 11 kb, 14 kb et 6,5 kb pour les plantes P5, P7 et P10, respectivement. Cela démontre l'intégration du gène cryIA(a) dans le génome des transformants (voir figure). Voir caractérisation moléculaire des transgènes (cours).

3/ Comment les auteurs se sont rendus compte du site d'insertion du transgène et du nombre de copies du intégrées dans l'ADN de chaque plante de pomme de terre?

Ils ont procédé par une technique appelée 'inverse PCR' (IPCR). Comme le montre la figure B beaucoup de plants ont intégré le transgène en plusieurs copies (1-4).

La PCR inverse est une variante de la PCR utilisée quand on connaît uniquement une seule séquence (ex. un transgène) entourée par des séquences inconnues et où on ne dispose pas d'amorces pour l'amplification (voir figure). On procède par:

- Digestion sur les séquences inconnues entourant la séquence connue (transgène).

- Conversion des fragments d'ADN obtenus en ADN circulaire par une ligation interne.

- Digestion des ADN circulaires par une enzyme de restriction qui opère uniquement au niveau de la séquence connue (transgène).

On en génère des fragments d'ADN circulaire qu'on peut amplifier par des amorces qui reconnaissent une partie de la séquence connue (transgène).

Avec la PCR inverse; on peut se rendre compte où le transgène s'est inséré. En effet, l'inconvénient de la PCR conventionnelle et l'exigence de deux amorces devant être fixées aux extrémités du gène à amplifier. Avec un gène connu positionné à côté du gène inconnu, on peut créer à partir du premier ces deux amorces pour amplifier le gène inconnu.

Inverse PCR

Inverse PCR is especially useful for the determination of insert locations. For example, various retroviruses and transposons randomly integrate into genomic DNA. To identify the sites where they have entered, the known, "internal" viral or transposon sequences can be used to design primers that will amplify a small portion of the flanking, "external" genomic DNA. The amplified product can then be sequenced and compared with DNA databases to locate the sequence which has been disrupted. (Wikipedia)


4/ Comment expliquer l'absence d'amplification du gène dans 5 plants (parmi 29) ayant survécu dans un milieu de culture contenant la Kanamycine (propriété due au gène marqueur NPTII)?. Le marqueur est présent, tandis que le gène d'intérêt est absent !. Le fait que les amorces préparées pour amplifier le transgène CryIA(a) n'ont pas amplié ce gène dans les transformants peut être expliqué par l'existence de problèmes liés à la réplication et la réparation des transgènes dans les cellules?
5/ Comment les auteurs ont vérifié l'expression du transgène CryIA(a) intégré dans l'ADN de chaque plante de pomme de terre (transcription du gène)?

Les auteurs ont utilisé la technique du 'Northern blotting' qui consiste détecter l'ARN (après transfert sur membrane) par hybridation avec une sonde marquée (ici ADN du transgène). Pour analyser l'expression du transgène CryIA(a) dans les plants transgéniques de la pomme de terre, l'ARN total a été isolé à partir des feuilles et hybridé avec l'ADN de la région codante du transgène. Les résultas montrent la présence de transcrits du gène dans les feuilles avec des niveaux d'expression différents (voir figure). D'autre part, la révélation par bromure d'éthidium de l'ARN ribosomique (rRNA) démontre que la quantité du RNA total appliquée est approximativement la même pour toutes les plantes transgéniques.

Certains plants ayant intégré plusieurs copies du transgène comme le plant P16, montrent l'absence de transcription du gène.

Potato. Northern blot of RNA

6/ Comment les auteurs ont pu vérifier la traduction du transgène dans les plants de pomme de terre?

Ils ont vérifier la traduction du transgène par les tests biochimiques utilisant la technique dot blot similaire à la technique 'western blotting'. Voir partie du cours relative à la caractérisation biochimique des transformants.

7/ Comment expliquer l'activité faible de l'expression du transgène (voir figure) dans certains transformants qui contiennent plusieurs copies du transgène?

L'activité faible de l'expression du transgène CryIA(a) peut être liée à plusieurs facteurs dont 1/ Phénomène de 'silencing' épigénétique de l'expression du gène par des séquences répétées de DNA, 2/ Co-suppression par interférence de brins d'ARN et 3/ DNA méthylation.

Aussi, l'activité faible du transgène peut être due à l'instabilité du mRNA.

Transgène. Protéine dot blot

Cas 3. Soja résistant aux herbicides.

La variété de soja commercialisée sous le nom MON 89789 est une variété transgénique tolérant le glyphosate.

SOJA? SOYBEAN

Le glyphosate est la molécule active d'un herbicide total c'est-à-dire non sélectif utilisé pour le désherbage.

Glyphosate. OGM résistante

Par conséquent, il ne permet pas aux agriculteurs de l'utiliser dans le cadre des traitements qu'ils appliquent aux plantes cultivées dont le soja.

Le glyphosate est une molécule qui inhibe l'activité d'une enzyme, l'EPSPS (5-EnolylPyruvyl-Shikimate 3-Phosphate Synthase) (Enzyme sensible (ES)) qui dans le chloroplaste catalyse la formation d'acides aminés aromatiques, le tryptophane, la tyrosine et la phénylalanine. La fixation du glyphosate sur l'enzyme est à l'origine de son inhibition.

La synthèse de ces acides aminés étant bloquée, de nombreuses voies métaboliques se trouvent affectées entraînant en quelques jours la mort du végétal.
Certaines bactéries naturellement présentes dans le sol possèdent un gène codant pour une enzyme EPSPS (Enzyme tolétante (ET)) tolérant le glyphosate tout en conservant sa capacité à catalyser la synthèse d'acides aminés.

La variété MON 89789 a été obtenue par modification génétique de la variété commerciale de soja A3224 selon une transformation biologique par Agrobacterium tumefaciens.
Une technique permettant de localiser les gènes sur l'ADN a montré l'insertion d'une copie du gène cp4-epsps à un seul locus dans le génome du soja.


Cas du 'terminator' chez les semences
Le concept 'Terminator', dont le brevet est détenu par la compagnie Monsanto, désigne une technique visant l'introduction d'un transgène (gène exogène tueur) qui bloque le développement du germe d'un grain.

La plante se développant hibituellement et donnant une récolte normale, produit cependant un grain stérile.

La technologie 'Terminatorr' fonctionne avec trois gènes et un inducteur chimique:

- Le gène 1 est un gène répresseur codant pour une protéine régulatrice qui se fixe sur un site opérateur en amont des gènes de structure et inhibe leur transcription. La protéine régulatrice du gène 1 (réprésseur) se fixe sur le site de fixation ('binding site' du gène 2

- Le gène 2 ou gène de l'enzyme recombinase est placé sous le contrôle d'un promoteur. Le site de fixation du répresseur est localisé entre le Promoteur et le gène de la recombinase. Le gène 2 produit une enzyme de restriction qui coupe l'ADN 'blocker' du gène 3. Les recombinases sont des enzymes permettant la recombinaison génétique. Les DNA recombinases permettent de manipuler la structure du génome et contrôler l'expression des gènes. Ces enzymes catalysent les réactions d'échange d'ADN dans un sens défini, entre des sites spécifiques déterminés par de courtes séquences (30 à 40 nucléotides) propres à chaque recombinase. Ces réactions rendent possibles quatre modules fonctionnels: 1/ Excision/insertion, 2/ Inversion, 3/ Translocation et Echange de cassettes.

- Le gène 3 ou gène de la toxine létale pour l'embryon. Il est sous le contrôle d'un promoteur tardif qui est activé seulement durant le développement de la graine, pendant la croissance de l'embryon. L'ADN 'Blocker' est localisé entre le promoteur tardif ('late promoter') et le gène 3. L'excision de L'ADN 'Blocker' favorise, la transcription et l'expression du gène de la toxine létale. Une toxine, ainsi produite, tue l'embryon et rend stériles les nouvelles semences (pour une reproduction).

- Afin d'activer les gènes 2 (recombinase) et le gène 3 (toxine), un 'inducteur chimique (tétracycline, par exemple) est répandu sur les semis par les compagnies de semences comme Monsanto et Syngeta. Une fois ces gènes activés dans les semences, on peut avoir la production mais pas le reproduction.

Terminator inactif

Terminator actif

Etapes d'activation du gène terminator dans les semences de vente aux agriculteurs:
1/ Introduction de l'inducteur (par exemple du tétracycline) dans les semences,
2/ L'inducteur bloque le 'binding site' au niveau du gène 2 (recombinase) et empêche la ficxation du répresseur,
3/ L'ARN polymérase se lie au promoteur et commence la transcription du gène de la recombinase (isomérase) en ARN d'où synthèse de l'enzyme recombinase.
4/ La recombinase taille et coupe la séquence 'blocker',
5/ L'ARN polymérase se lie au 'late promoter' et transcrit le gène de la toxine.
Il en résulte la synthèse de la toxine qui tue les embryons des graines avant les récoltes.


OGMs en afrique

Afrique. OGM


- -

Gène - génie génétique