biotechnologies logo


Recherche dans ce site et les sites liés (Fr, Ar, Eng) - بحث سريع في هذا الموقع و المواقع المرتبطة للمؤلف



Transformation génétique du tabac et de la pomme de terre par le gène de la chitinase du champignon Trichoderma harzianum. Examen


La transformation génétique des plantes comme le tabac et la pomme de terre, par le gène de la chitinase du champignon Trichoderma harzianum, peut leur faire acquérir une résistance à plusieurs champignons.
Contrôle de la matière 'Marqueurs moléculaires et Amélioration des plantes' du module 'Biotechnologies et amélioration des plantes', parcours 'Biologie appliquée aux productions végétales', S6, Juin 2016", Faculté Sciences-Semlalia, Université Cadi Ayyad, Marrakech, Maroc. Durée : 75 minutes .......... Corrections brèves à la fin de l'épreuve. ----> Liens à contenu similaire

Afin d'améliorer la résistance du tabac (Nicotiana tabacum) et de la pomme de terre (Solanum tuberosum) aux attaques des champignons Alternaria alternaria, Alternaria solani, Botrytis cinerea, et Rhizoctonia solani, Lorito et al. (Proc. Natl. Acad. Sci. USA 95,7860-7865, 1998) ont développé des plants transgéniques de tabac et de la pomme de terre exprimant un gène codant pour la chitinase (enzyme hydrolytique de la paroi cellulaire) du champignon Trichoderma harzianum.

Les plantes transformés et inoculées par des champignons pathogènes (infections à travers les feuilles ou les racines) ont été testées pour leurs activités chitinase et l'expression des symptômes externes des maladies fongiques (Fig. 1). Ainsi, l'inoculation par Alternaria alternaria (infection à travers les feuilles) de plants de tabac transformés (Tx1, Tx3, Ts2, Ts3, Ts4, Ts5) et non transformés ('control'), a permis d'obtenir les résultats montrés par la figure 1.

De même, la résistance à Rhizoctonia solani (infection à travers les racines) des plants de pomme de terre transformés a été testée par culture des plantes sur un sol infesté par ce champignon. En général, les plants de pomme de terre transformés n'ont pas montré de symptômes d'attaque par Rhizoctonia solani. Agrobacterium tumefaciens a été utilisé comme vecteur dans la transormation des plantes (transformation par système binaire).

Chitinase Trichoderma

Fig.1
VISUALISER CETTE IMAGE COMPLETE DANS UNE NOUVELLE FENETRE


Analyse moléculaire et biochimique des transformants


La présence et l'expression du transgène chitinase chez les transformants ont été suivies par les techniques de PCR, 'Southern blotting', 'Northern blotting' et 'Western blotting' (Fig. 2). Les analyses par PCR ont été faites par des amorces EC1, Bio 1N et BB2:
- Amorce EC1: GGTTATGCTTTCCATCGG se fixant à 566 pb de l'extrémité 5' du gene,
- Amorce Bio 1N: GTGGTAGCCCGGAGCGTATT se fixant à 813 pb de l'extrémité 5' du gene et
- Amorce BB2: CAAGGAGTCAGAGCCAGTCTT se fixant à 1367 pb de l'extrémité 5' du gene.

Les différentes amplifications ont été réalisées par les paires d'amorces EC1-Bio1N et EC1-BB2 qui produisent des fragments d'ADN de 250 pb et 800 pb, respectivement (figure 2A).

Chitinase. Transformation génétique
VISUALISER CETTE IMAGE COMPLETE DANS UNE NOUVELLE FENETRE

Fig. 2


- Plants témoins (non transformés): pour le tabac : Cs, Cx, pour la pomme de terre : Cp.

- Plantes transgéniques : plants de tabac transformés: Ts (N° de la plante) et Tx(N° de la plante), plants de pomme de terre transformés: Tp(N° de la plante).

E : endochitinase pure de Trichoderma harzianum.

A: amplification par PCR (avec les paires d'amorces EC1-Bio1N et EC1-BB2) du transgène du champignon avec l'ADN du champignon (F) comme témoin.

B: Analyse de L'ARN des tissues de plantes en utilsant comme sonde l'ADNc ThEn-42.

C: Analyse de l'hydrolysat par BamHI des ADN de tabac et de la pomme de terre détectés par hybridation avec des fragments de 1,7 kb de l'ADN du gène ThEn-42.

D: Analyse des proteins solubles des feuilles de tabac et de la pomme de terre séparées par électrophorèse en présence de SDS (SDS-PAGE) et visualisées avec un anticorps contre la chitinase marqué par la phosphatase alcaline.


1. Rappeler Le principe de transformation génétique des plantes par Agrobacterium tumefaciens comme vecteur (système binaire).
2. Quelles sont les différences principales entre les marqueurs moléculaires de type RFLP et les marqueurs de type RAPD, basés sur la PCR (utiliser un tableau mentionnant la nature des extraits de l'ADN, étapes principales, enzymes utilisées, reproductibilité, caractère du marquage, temps de réalisation, utilisation de sondes marquées).
3. En se référant aux résultats relatifs aux analyses des plantes transformées (Fig. 2), spécifier l'expérience qui a montré l'insertion du transgène codant pour la chitinase du champignon Trichoderma harzianum. Justifier votre réponse.
4. Spécifier l'expérience qui renseigne sur le nombre de copies du transgène intégré dans les ADN des plants de tabac et des plants de pomme de terre. Déterminer ce nombre pour les deux plantes.
5. Spécifier l'expérience qui renseigne sur la transcription du transgène intégré dans les ADN des transformant. Interpréter briévement les résultats. Par quoi diffère un ADNc d'un ADN ?. Quelle pourrait être l'origine de l'intensité forte de la bande du plant de tabac Ts3.
6. Spécifier l'expérience qui renseigne sur l'expression en protéines (traduction) du transgène intégré dans les ADN des transformants. Interpréter briévement les résultats.
7. Interpréter briévement les résultats relatifs aux symptômes d'attaque fongique et aux activités de chitinase montrées par les plantes transformées et les plantes témoins (Fig. 1A, B).
8. Quelles peuvent être les applications possibles de la transformation génétique des plantes par le gène de la chitinase du champignon Trichoderma harzianum et celles qui pourraient résulter de l'utilisation de ce même champignon> dans les stratégies d'amélioration des plantes.


LIRE LA SUITE DE L'EXAMEN





Corrections brèves


-->Revenir aux questions
Réponse à la Question 1: Principe de transformation génétique des plantes par Agrobacterium tumefaciens comme vecteur (système binaire).

La transformation génétique des plante par le vecteur Agrobacterium tumefaciens selon le système binaire consiste à utiliser un Agrobactrium recombinant contenant deux plasmides dont le plasmide de virulence (désarmé et apportant les gènes de virulence) et un plasmide binaire construit dans E.Coli et contenant contenant le gène d'intérêt). Un troisième plasmide dit 'plasmide helper', est également utilisé pour améliorer le transfert du plasmide binaire d’E. coli vers A. tumefaciens grâce à ses gènes tra (pour transfer) et mob (pour mobilization) codant pour les protéines tra et mob. L'Agrobacterium recombinant est issu d'une conjugaison triparentale. Lien utile : Transformation génétique par Agrobacterium tumefaciens.

Réponse à la Question 2: Différences principales entre les marqueurs moléculaires de type RFLP et les marqueurs de type RAPD, basés sur la PCR.

  RFLP RAPD
Nature des extraits de l'ADN ADN hautement purifié ADN partiellement purifié
Etapes principales Digestion de l'ADN, électrophorèse, transfert des fragments d'ADN sur membrane de nitrocellulose, révélation avec une sonde marquée Amplification de l'ADN à l'aide d'amorces en présence de Taq DNA polymérase, électrophorèse, révélation par une méthode appropriée comme celle utilisant le bromure d'éthidium.
Enzymes utilisées Enzyme de restriction de l'ADN Taq DNA polymérase
Reproductibilité Elevée Moyenne
Caractère du marqueur (déterminisme) Codominant. Les individus hétérozygotes se distinguent facilement des parents Dominant. Les individus hétérozygotes difficiles à distinguer des parents
Temps de réalisation long Rapide
Utilisation de sondes marquées Oui Non

Réponse à la Question 3: Analyse moléculaires et biochimiques des transformants. Spécifier l'expérience qui a montré l'insertion du transgène codant pour la chitinase du champignon Trichoderma harzianum. Justifier votre réponse.

L'expérience qui montre l'insertion du transgène (chitinase du champignon) dans l'ADN du tabac correspond à une simple PCR utilisant les paires d'amorces EC1-Bio1N et EC1-BB2). Les résultats sont relatés dans la figure 2A. Les plantes transgéniques contiennent le transgène. L'amplification du gène à partir de l'ADN de Trichoderma harzianum (contrôle F) montre qu'il s'agit bien de la chitinase du champignon.

Réponse à la Question 4: Analyse moléculaires et biochimiques des transformants. Spécifier l'expérience qui renseigne sur le nombre de copies du transgène intégré dans les ADN des plants de tabac et des plants de pomme de terre. Déterminer ce nombre pour les deux plantes.

L'expérience qui renseigne sur le nombre de copies du transgènes intégré correspond à celle du 'Southern blotting' où les résultats sont relatés dans la figure 2C. Les ADN des plantes ont été hydrolysés par BamHI et séparés par électrophorèse. Après transfert sur membranes de nitrocellulose, une hybridation de l'ADN a été faite avec des sondes constituées de fragments de 1,7 kb de l'ADN du gène ThEn-42 (chitinase). Les plantes de tabac ont intégré 1, 2 ou 3 copies du transgène. Les plants de pomme de terre en ont intégré une seule copie.

Lien: Nombre de copies du transgène intégré

Réponse à la Question 5: Analyse moléculaires et biochimiques des transformants. Spécifier l'expérience qui renseigne sur la transcription du transgène intégré dans les ADN des transformant. Interpréter briévement les résultats. Par quoi diffère un ADNc d'un ADN ?. Quelle pourrait être l'origine de l'intensité forte de la bande du plant de tabac Ts3.

L'expérience qui renseigne sur la transcription du transgène intégré dans les ADN des transformants correspond à celle du 'Northern blotting' où les résultats sont relatés dans la figure 2B. Ils proviennent de l'hybridation de L'ARN des tissues de plantes par une sonde d'ADNc ThEn-42 (chitinase). L'ADNc diffère de l'ADN par l'absence d'introns. Il reflète la succession des exons uniquement. Le plants de tabac transformé Ts3 montre une grande accumulation des ARNm (intensité élevée de la bande) qui serait liée au nombre élevé de copie du transgènes intégré (3) (Fig 2C).

Réponse à la Question 6: Analyse moléculaires et biochimiques des transformants. Spécifier l'expérience qui renseigne sur l'expression en protéines (traduction) du transgène intégré dans les ADN des transformants. Interpréter briévement les résultats.

L'expérience qui renseigne sur l'expression en protéines (chitinase) du transgène intégré dans les ADN des transformants correspond à celle du 'Western blotting' où les résultats sont relatés dans la figure 2D. Après séparation des protéines par éléctrophorèse SDS PAGE et transfert sur membrane de nitrocellulose, les protéines sont révélées par un anticorps anti-chitinase marqué à la phosphatase alcaline (produit coloré visible). Aussi bien les plants de tabac que de la pomme de terre expriment (traduction) au niveau des feuilles le transgène de la chitinase du champignon Trichoderma harzianum. D'après l'intensité des bandes, il semble que le tabac exprime mieux le transgène chitinase par rapport à la pomme de terre.

Réponse à la Question 7: Interprétation des résultats relatifs aux symptômes d'attaque fongique et aux activités de chitinase montrées par les plantes transformées et les plantes témoins (Fig. 1 A, B).

La figure 1A montre l'absence des symptômes externes de Alternaria alternaria sur les feuilles de plants de tabac transformés par le gène de chitinase du champignon Trichoderma harzianum et infestés par A. alternaria. Les plants non transformés (témoins) sont sévèrement attaqués par ce dernier. La figure 1B montre que l'activité des chitinases est inversement proportionnelle au pourcentage de plants montrant des symptômes de A. alternaria. Néanmoins, la réponse des plantes à l'infection reste variable d'une plante à l'autre.

Réponse à la Question 8: Les applications possibles de la transformation génétique des plantes par le gène de la chitinase du champignon Trichoderma harzianum et celles qui pourraient résulter de l'utilisation de ce même champignon dans les stratégies d'amélioration des plantes.

Les applications pouvant découler de cette étude sont:

1/ Introduction dans les Solanacées (comme le tabac et la pomme de terre) la résistance à plusieurs types de champignons (existant dans l'air et dans les sols) à travers les transformations génétiques des plantes par la chitinase du champignon Trichoderma harzianum.

2/ Utilisation du champignon Trichoderma harzianum dans le contrôle biologique (biocontrôle) pour anéantir l'effet d'autres champignons pathogènes (antagonisme).


Réseaux sociaux تبادل المعلومة عبر المواقع الإجتماعية

facebook google plus Twitter Linkedin

BIOTECH-ECOLO SUPPORTS

ANNONCES


LIENS UTILES:


- Plantes. Transgénèse, génie génétique
- Transformation sens (chitinase)
- Chitinase engineered plants
- Chitinase. Tests
- RFLP et sélection des protoplastes chez l'oranger. Examen S5_2012
- RFLP, RAPD et sélection chez le Cyprès du Japon (examen 2013)
- RAPD et sélection de la tomate. Examen S5_2012
- Microsatellites (SSR) et transgénèse chez le niébé. Examen S6 2017
- Polygalacturonase. Transformation (contrôle)
- Transformation du bouleau avec la toxine BGT (contrôle)


Diversité génétique

Bouleau. Transformation génétique. Examen